Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.047324 |
Chromosome: | chromosome 2 |
Location: | 3693364 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g095050 | (1 of 77) IPR012340 - Nucleic acid-binding, OB-fold | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGGGAGCTAAGGCGCGGCAACGGCAACT |
Internal bar code: | ATAAGAAGAAGCAAACAAGGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 458 |
LEAP-Seq percent confirming: | 88.0282 |
LEAP-Seq n confirming: | 125 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGAAGAAGCAAAACTCCG |
Suggested primer 2: | GCCATGCCTCTTACGCTTAG |