Insertion junction: LMJ.RY0402.047353_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.047353
Chromosome:chromosome_12
Location:3577252
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre12.g513650 sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TTAAGACGAATTGAGACACTGGGTATGTAG
Internal bar code:GGACGGTCGTGCTGACGAGCGG

Confirmation - LEAP-Seq

LEAP-Seq distance:640
LEAP-Seq percent confirming:99.5696
LEAP-Seq n confirming:1388
LEAP-Seq n nonconfirming:6
LEAP-Seq n unique pos:9

Suggested primers for confirmation by PCR

Suggested primer 1:AGGAAAGTGGTGGAGGAGGT
Suggested primer 2:CCTAGGGATGTGCAGGTGTT