Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.047537 |
Chromosome: | chromosome 6 |
Location: | 3914491 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g278183 | (1 of 1) PTHR23054//PTHR23054:SF14 - UNCHARACTERIZED // PROTEIN Y45F10A.7, ISOFORM A | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAACTCAGACATCAGTATACATACGCCCAG |
Internal bar code: | ACTTGGGGCAAGTCTTTTACAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 934 |
LEAP-Seq percent confirming: | 52.7684 |
LEAP-Seq n confirming: | 1563 |
LEAP-Seq n nonconfirming: | 1399 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TATTCCACCGACGGTCTTTC |
Suggested primer 2: | CGGATGAGCTGTGTAGACGA |