Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.047565 |
Chromosome: | chromosome 4 |
Location: | 1598080 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g213250 | (1 of 2) K01256 - aminopeptidase N (pepN) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCTTGAAATTACTAAGTTAATGCCTGCC |
Internal bar code: | CGAGGCCAGCGTATCCCAACCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 181 |
LEAP-Seq percent confirming: | 86.1861 |
LEAP-Seq n confirming: | 2427 |
LEAP-Seq n nonconfirming: | 389 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCCACGTGACATGACCTAT |
Suggested primer 2: | GCACCACACATGCACATACA |