| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.047585 |
| Chromosome: | chromosome 10 |
| Location: | 3038263 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g441300 | (1 of 11) IPR001471//IPR016177//IPR031112 - AP2/ERF domain // DNA-binding domain // AP2-like ethylene-responsive transcription factor | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCTGGTCTGCCGGCCCGCTACCACCGCC |
| Internal bar code: | CCGCTGGGTCATTCTCAACTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 576 |
| LEAP-Seq percent confirming: | 98.1982 |
| LEAP-Seq n confirming: | 109 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTGCAGCGGCTTTATTCAT |
| Suggested primer 2: | AAATCCCTGTTCACATTCGC |