Insertion junction: LMJ.RY0402.047588_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.047588
Chromosome:chromosome_9
Location:4983085
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre09.g397993 Similar to Flagellar Associated Protein FAP201 sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):GTGTGAGGACGGTGTGGGCGGTGTGGAGGA
Internal bar code:GGAGCTACTCGGGGTGCGTTGT

Confirmation - LEAP-Seq

LEAP-Seq distance:908
LEAP-Seq percent confirming:99.5077
LEAP-Seq n confirming:8085
LEAP-Seq n nonconfirming:40
LEAP-Seq n unique pos:53

Suggested primers for confirmation by PCR

Suggested primer 1:GCTTGCTTTAGTTTGGGCTG
Suggested primer 2:TAGCTTACATGGATGCAGCG