Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.047642 |
Chromosome: | chromosome 3 |
Location: | 637412 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g145767 | RRP6,RRP6a | putative exosome subunit; (1 of 1) K12951 - cation-transporting P-type ATPase D (ctpD) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGTCCATTACAGCTGCCCCATGCCCCTCC |
Internal bar code: | GAGACAGTCTTCATAGGGCGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 71 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 65 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAACAATTCTGGCAAGCTCA |
Suggested primer 2: | AGGAGAGGGAGAGGATGAGC |