Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.047656 |
Chromosome: | chromosome 9 |
Location: | 2207977 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g392950 | TMG12 | tRNA (guanosine-2'-O)-methyltransferase; (1 of 1) PTHR12029//PTHR12029:SF55 - RNA METHYLTRANSFERASE // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCTTGCGCGTGGGTGCACGTGAGCGGGG |
Internal bar code: | GACTGCGTACGTGGGACGGTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 119 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 542 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTGCACGTACAAGGAGTGA |
Suggested primer 2: | TGGCGCTCTACATCTCCTTT |