Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.047665 |
Chromosome: | chromosome 3 |
Location: | 6470858 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g194900 | CYA4 | Lipocalin-like adenylate cyclase; (1 of 3) PTHR11017//PTHR11017:SF145//PTHR12203//PTHR12203:SF13 - LEUCINE-RICH REPEAT-CONTAINING PROTEIN // SUBFAMILY NOT NAMED // KDEL LYS-ASP-GLU-LEU CONTAINING - RELATED // F10K1.7 PROTEIN | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAAGTGGGGCGGGCGCCGGGGAAAGGGC |
Internal bar code: | ATCGTGATCCAAACCCGGATGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 255 |
LEAP-Seq percent confirming: | 35.5691 |
LEAP-Seq n confirming: | 1050 |
LEAP-Seq n nonconfirming: | 1902 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCCCGTCCTCCATACTATT |
Suggested primer 2: | TCTACCACACTCCCCACCTC |