| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.047676 |
| Chromosome: | chromosome 10 |
| Location: | 3299006 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g443400 | (1 of 41) IPR000719//IPR011009 - Protein kinase domain // Protein kinase-like domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCAACCGATCGAGCTCCACCCTCCCCTG |
| Internal bar code: | GAGCAGGGGCGTTACCGCCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1008 |
| LEAP-Seq percent confirming: | 98.8134 |
| LEAP-Seq n confirming: | 10326 |
| LEAP-Seq n nonconfirming: | 124 |
| LEAP-Seq n unique pos: | 82 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGGCCAAGAGCTTAACTG |
| Suggested primer 2: | GTGACGAATCCAGGAAAGGA |