| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.047818 |
| Chromosome: | chromosome 5 |
| Location: | 2805587 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g237250 | (1 of 752) IPR027417 - P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTAGGGCGGCCATCAGGAAAGCTGATCTC |
| Internal bar code: | GGTCCGAGACTAGTTACAGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 441 |
| LEAP-Seq percent confirming: | 74.3708 |
| LEAP-Seq n confirming: | 2571 |
| LEAP-Seq n nonconfirming: | 886 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTAGGACAGCCATAGCCTGC |
| Suggested primer 2: | TTTCTCGTTCAACATGCTCG |