| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.047904 |
| Chromosome: | chromosome 7 |
| Location: | 1324166 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g322250 | CNX6 | Molybdenum cofactor biosynthesis protein; (1 of 2) 2.8.1.12 - Molybdopterin synthase / MPT synthase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCGTGGAGACACCCACACCCGGACGCAC |
| Internal bar code: | CCTGAGGCCGGGTCCCTCCTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 349 |
| LEAP-Seq percent confirming: | 88.0407 |
| LEAP-Seq n confirming: | 1038 |
| LEAP-Seq n nonconfirming: | 141 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTACTCTGCGCTTGGATGTG |
| Suggested primer 2: | GGCGCTGAAGAAACTACAGG |