| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.047999 |
| Chromosome: | chromosome 10 |
| Location: | 5201014 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g456900 | FPN4 | (1 of 2) PTHR12103//PTHR12103:SF21 - CYTOSOLIC PURINE 5-NUCLEOTIDASE-RELATED // IMP-GMP SPECIFIC 5-NUCLEOTIDASE, PUTATIVE-RELATED; Purine 5'-nucleotidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGATAGCCGTGCAGGATGGGTCGTCTTGAA |
| Internal bar code: | GGAAGTTGGAAGGAGCCATATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 527 |
| LEAP-Seq percent confirming: | 92.703 |
| LEAP-Seq n confirming: | 902 |
| LEAP-Seq n nonconfirming: | 71 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCATGTTGTTTGGGTGCAG |
| Suggested primer 2: | ATGACACAACGATTCCGACA |