Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.048087 |
Chromosome: | chromosome 3 |
Location: | 8842888 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g206817 | (1 of 2) IPR001739//IPR016177 - Methyl-CpG DNA binding // DNA-binding domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGTCGCCGGGCAGCCTGGCGTGTGCTGG |
Internal bar code: | CTGCTAGGTCGCCCGCCTACGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 406 |
LEAP-Seq percent confirming: | 99.7247 |
LEAP-Seq n confirming: | 2536 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATTCAGTTACGCCGAGCTGT |
Suggested primer 2: | TGAGTTCAATGGGGAGGTTC |