| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.048088 |
| Chromosome: | chromosome 16 |
| Location: | 6125489 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g675700 | BLZ21 | (1 of 2) IPR000104//IPR004827 - Antifreeze protein, type I // Basic-leucine zipper domain; bZIP transcription factor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTAGTGCATCGCATTGGACAGCGCCGCAA |
| Internal bar code: | TGGCGTCCTCCACGGCGTCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 936 |
| LEAP-Seq percent confirming: | 99.6941 |
| LEAP-Seq n confirming: | 27702 |
| LEAP-Seq n nonconfirming: | 85 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATATGCCGTCGCACATGTAA |
| Suggested primer 2: | ATGTAGCCCGGAACAGTACG |