| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.048128 |
| Chromosome: | chromosome 3 |
| Location: | 8070189 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g201150 | (1 of 2) 2.5.1.117 - Homogentisate solanesyltransferase / HST | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTGCTGCAATGACTGGGCCGGCACCGGG |
| Internal bar code: | TCGTGCTACGGGTGCGTCGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 875 |
| LEAP-Seq percent confirming: | 92.8633 |
| LEAP-Seq n confirming: | 10839 |
| LEAP-Seq n nonconfirming: | 833 |
| LEAP-Seq n unique pos: | 69 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGCGAGTACGGTGCTGAGT |
| Suggested primer 2: | ACCATCCTTGTTTCACCAGC |