| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.048201 |
| Chromosome: | chromosome 16 |
| Location: | 506276 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g692902 | AHI1 | Abelson-helper integration site 1; (1 of 3) PTHR22847:SF361 - JOUBERIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCACCTTCGCGACACGGCTGCCCTCACAC |
| Internal bar code: | AGAACGGATGGACCCATATTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 374 |
| LEAP-Seq percent confirming: | 46.5564 |
| LEAP-Seq n confirming: | 1548 |
| LEAP-Seq n nonconfirming: | 1777 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGATCAAGGAGGACCAACT |
| Suggested primer 2: | TGTCGAGTTGACCTACGCAC |