| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.048420 |
| Chromosome: | chromosome 9 |
| Location: | 2877157 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g388450 | ELG29 | Exostosin-like glycosyltransferase 29; (1 of 2) PTHR31389:SF4 - PROTEIN F32B4.1 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCTTGCGCGTGGACGAGCTCGCGTACAG |
| Internal bar code: | CGTGGTCGATAGAATGGCAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 759 |
| LEAP-Seq percent confirming: | 99.591 |
| LEAP-Seq n confirming: | 4870 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGGATGATACAACCGCAAG |
| Suggested primer 2: | TTCTGCTGAGTCAACCATGC |