| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.048520 |
| Chromosome: | chromosome 8 |
| Location: | 4329088 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g381483 | SDR15 | (1 of 239) IPR016024 - Armadillo-type fold; Short-chain dehydrogenase/reductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCCCCCCGCCCAGGCATGTGGGGCTTTT |
| Internal bar code: | GCTATGGGTTTCCCATCGCTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 130 |
| LEAP-Seq percent confirming: | 99.466 |
| LEAP-Seq n confirming: | 745 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGTCCCCAAGATGGTCTA |
| Suggested primer 2: | GGGAAGAGGAGTGAGGGAGA |