Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.048533 |
Chromosome: | chromosome 17 |
Location: | 2113019 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g712400 | TERC1,TERC | Thylakoid protein integration factor; (1 of 1) PTHR30238:SF0 - PROTEIN PIGMENT DEFECTIVE 149 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTACCGGGGCGTAAGGGCGCAGAGAAAACG |
Internal bar code: | CCCCTGGCCCATCGAGTATATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 925 |
LEAP-Seq percent confirming: | 99.1047 |
LEAP-Seq n confirming: | 4760 |
LEAP-Seq n nonconfirming: | 43 |
LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAAGTTGGTGCCGTCGTATT |
Suggested primer 2: | GCACGGGAGGACAGTGTATT |