| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.048625 |
| Chromosome: | chromosome 3 |
| Location: | 6066338 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g191350 | (1 of 1) K05642 - ATP-binding cassette, subfamily A (ABC1), member 2 (ABCA2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCTAGGGTGAGGCCTGGGGCTGGGAAAA |
| Internal bar code: | GCAATCGGTGGTGTCGCGCTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 376 |
| LEAP-Seq percent confirming: | 99.3141 |
| LEAP-Seq n confirming: | 724 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCATGTTGGTGGAGGAGG |
| Suggested primer 2: | TAGCACAAGCACCTCGATTG |