| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.048723 |
| Chromosome: | chromosome 7 |
| Location: | 3630810 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g337000 | CSD3 | (1 of 2) 5.1.1.17 - Isopenicillin-N epimerase; Putative cysteine desulfurase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGGCCCCACATGAGGTCACATCCTCACA |
| Internal bar code: | TGTCACAGTCCAGGATACGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 693 |
| LEAP-Seq percent confirming: | 99.3767 |
| LEAP-Seq n confirming: | 6059 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACGCAACACAAGGTATGC |
| Suggested primer 2: | GTCTAGTTTCGCTTCTGGCG |