Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.048730 |
Chromosome: | chromosome 6 |
Location: | 605144 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g253300 | UBCH1 | (1 of 1) K05610 - ubiquitin carboxyl-terminal hydrolase L5 [EC:3.4.19.12] (UCHL5, UCH37) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACTCCGACGACACACGTCCTCACCGACA |
Internal bar code: | CTGTGGACGCGCATCTACGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1172 |
LEAP-Seq percent confirming: | 99.659 |
LEAP-Seq n confirming: | 7599 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATAGTTGCCATGGTATGCG |
Suggested primer 2: | CGCTTTCCGTCTTGACTTTC |