| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.048835 |
| Chromosome: | chromosome 12 |
| Location: | 4624912 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g522850 | HEL55 | (1 of 1) K12835 - ATP-dependent RNA helicase DDX42 (DDX42, SF3B125); DEAD/DEAH box helicase similar to Eukaryotic Initiation Factor 4A | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAGGCTGCCGCACGCACCAATGGCGCCAC |
| Internal bar code: | GTACGTAGGTGAAAGCGTAAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 316 |
| LEAP-Seq percent confirming: | 74.2261 |
| LEAP-Seq n confirming: | 1103 |
| LEAP-Seq n nonconfirming: | 383 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGACACTCTCACTTGGTGC |
| Suggested primer 2: | TGATATCAGTCCGGGAGGAG |