Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.048847 |
Chromosome: | chromosome 16 |
Location: | 4913176 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g685650 | GLR1 | Ionotropic glutamate receptor; (1 of 4) PF00060//PF00497 - Ligand-gated ion channel (Lig_chan) // Bacterial extracellular solute-binding proteins, family 3 (SBP_bac_3) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCCGTGCCTACCTTCAGGTCAGTGTGTC |
Internal bar code: | TGGTATGCTATCTTCTAATATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 467 |
LEAP-Seq percent confirming: | 99.5799 |
LEAP-Seq n confirming: | 15645 |
LEAP-Seq n nonconfirming: | 66 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGAGTTTGCGGCTTCACCTA |
Suggested primer 2: | CTTACAGTGGAGGAGCGGAG |