Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.048865 |
Chromosome: | chromosome 17 |
Location: | 2701169 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g717950 | PHC28,PHC6 | (1 of 24) IPR003882//IPR024616 - Pistil-specific extensin-like protein // Pherophorin; Pherophorin-chlamydomonas homolog 6 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACAGATGTGCAGAAGTAGTCTCGCGGTT |
Internal bar code: | AAGGCATCTAAAGCGCTACAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 240 |
LEAP-Seq percent confirming: | 95.1368 |
LEAP-Seq n confirming: | 626 |
LEAP-Seq n nonconfirming: | 32 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCCTGGTAACCCCTCAACA |
Suggested primer 2: | CGTTTCGTCTTGGTCCAAAT |