| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.048912 |
| Chromosome: | chromosome 8 |
| Location: | 4084141 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g379500 | (1 of 1) IPR000719//IPR002290//IPR011009//IPR020635//IPR029016 - Protein kinase domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain // GAF domain-like | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATTAGACTGCTGTGGGGTGTGGGGAGTA |
| Internal bar code: | CCACATCACCCCGGGATCAGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 772 |
| LEAP-Seq percent confirming: | 99.1511 |
| LEAP-Seq n confirming: | 1168 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGGACCCACGTCTGTAGG |
| Suggested primer 2: | GTGTTATTGTTCACCGTGCG |