Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.049160 |
Chromosome: | scaffold 18 |
Location: | 211843 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre18.g749697 | FUT11 | a-1%252C3-fucosyltransferase; (1 of 1) PTHR11929:SF131 - ALPHA-(1,3)-FUCOSYLTRANSFERASE 10 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGACAAGGCCGGGGAGAAAAGCCCAAGCC |
Internal bar code: | TGCAGTCTCCAGCCTTGACGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 295 |
LEAP-Seq percent confirming: | 99.5138 |
LEAP-Seq n confirming: | 614 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGCATTGCTTCCATACCCT |
Suggested primer 2: | TTTCGTGAACACCATGCAAT |