Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.049258 |
Chromosome: | chromosome 1 |
Location: | 5146257 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g035800 | IRK2 | (1 of 2) PTHR11767//PTHR11767:SF47 - INWARD RECTIFIER POTASSIUM CHANNEL // SUBFAMILY NOT NAMED; Inwardly-rectifying potassium channel | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAAACAGTAAAACAAAGACTCAACACACG |
Internal bar code: | AGAGAGAATCGTGTGCGAGCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 616 |
LEAP-Seq percent confirming: | 99.3454 |
LEAP-Seq n confirming: | 3794 |
LEAP-Seq n nonconfirming: | 25 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGCTGGGAAAAGCAACAAA |
Suggested primer 2: | CCGCTACAAACCGCTTATTC |