| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.049366 |
| Chromosome: | chromosome 11 |
| Location: | 3226289 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g479600 | MHX1,CAX6 | (1 of 1) K05849 - solute carrier family 8 (sodium/calcium exchanger) (SLC8A, NCX); putative Ca2+/Na+ exchanger | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTAACCCTACCCTCAACCTGACTTGTCCC |
| Internal bar code: | ACGTTTAGTTGTGATCCTACGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 952 |
| LEAP-Seq percent confirming: | 84.6015 |
| LEAP-Seq n confirming: | 1879 |
| LEAP-Seq n nonconfirming: | 342 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCCCTACTGCCTGATGCT |
| Suggested primer 2: | GCTCCTTTCTTCACTGGCAC |