| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.049380 |
| Chromosome: | chromosome 2 |
| Location: | 3764255 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095350 | DNK1,CGL116 | Conserved in the Green Lineage; (1 of 1) PTHR10513 - DEOXYNUCLEOSIDE KINASE | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGCGCACAGCAGGCCAGTAGCCAGCAGG |
| Internal bar code: | GTGCGAGCCGTGATAGGAGTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 215 |
| LEAP-Seq percent confirming: | 49.3349 |
| LEAP-Seq n confirming: | 2522 |
| LEAP-Seq n nonconfirming: | 2590 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATAGCGGAGCACAGGAAGA |
| Suggested primer 2: | GCTGTACCCAACCATCGAGT |