| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.049393 |
| Chromosome: | chromosome 6 |
| Location: | 8334123 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g306300 | CHLI1 | Magnesium chelatase subunit I, isoform 1; (1 of 2) PTHR32039:SF9 - MAGNESIUM-CHELATASE SUBUNIT CHLI-2, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCACACTGATCCTCGCTGCCCGATGCAGC |
| Internal bar code: | GGGGTACATCGTGGCCGCATTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1071 |
| LEAP-Seq percent confirming: | 99.3162 |
| LEAP-Seq n confirming: | 5810 |
| LEAP-Seq n nonconfirming: | 40 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGAGGTCCGTCTTGAGAGC |
| Suggested primer 2: | ATCCTCATGCTTGATTTGCC |