| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.049416 |
| Chromosome: | chromosome 10 |
| Location: | 1229949 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g426600 | CYP739A6,CYP27 | Cytochrome P450, CYP213 superfamily; (1 of 8) PTHR24286//PTHR24286:SF77 - FAMILY NOT NAMED // ABSCISIC ACID 8'-HYDROXYLASE 4 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCGGGCCGGAGCTGTCTTACAAGGCCGC |
| Internal bar code: | CTGCACAGGACGGGTTCCGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 810 |
| LEAP-Seq percent confirming: | 98.7409 |
| LEAP-Seq n confirming: | 1490 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTCTGGCTGTATGGCTCTG |
| Suggested primer 2: | CCGACACGAACAACATCAAC |