| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.049417 |
| Chromosome: | chromosome 3 |
| Location: | 1660057 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g153150 | (1 of 1) IPR000719//IPR001245//IPR001849//IPR002290//IPR011009//IPR011993//IPR020635 - Protein kinase domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Pleckstrin homology domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Pleckstrin-homology domain (PH domain)/Phosphotyrosine-binding domain (PTB) // Tyrosine-protein kinase, catalytic domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGCGCCATGGGTTCCTATGGAAGCGCTC |
| Internal bar code: | TCGGCTGTCTTGGCAGCCGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 541 |
| LEAP-Seq percent confirming: | 99.8413 |
| LEAP-Seq n confirming: | 6920 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGTGAAGTTCGTTCAGCA |
| Suggested primer 2: | TTGGTTGCTTTCATCAGCAG |