| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.049490 |
| Chromosome: | chromosome 13 |
| Location: | 2806007 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g583050 | Tic55-like5,TIC55-5,PAO8 | Pheophorbide a oxygenase-related protein; (1 of 3) K13071 - pheophorbide a oxygenase (PAO, ACD1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCTTTGCCGAGCGTTGGCGCACAACCGG |
| Internal bar code: | AAGCCGTTGGTGTTGAACGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 686 |
| LEAP-Seq percent confirming: | 98.991 |
| LEAP-Seq n confirming: | 1864 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGTATTCAGCTCGGTGCAA |
| Suggested primer 2: | GCAGGAGAAACATGTGAGCA |