| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.049491 |
| Chromosome: | chromosome 9 |
| Location: | 3880337 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g392060 | CrZIP11,ZIP4 | (1 of 5) K07238 - zinc transporter, ZIP family (TC.ZIP, zupT, ZRT3, ZIP2); Zinc/iron transporter | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCGCATCAAGGCGGGCCGCATGATGCGC |
| Internal bar code: | TAGCGACTGAACAAGATCCCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 66 |
| LEAP-Seq percent confirming: | 99.2 |
| LEAP-Seq n confirming: | 124 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAGCAGGCGTGTCGTTACT |
| Suggested primer 2: | CCGGAAGCAGTCCTACAGAG |