| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.049583 |
| Chromosome: | chromosome 7 |
| Location: | 4389213 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g341000 | (1 of 4) IPR017956//IPR020478 - AT hook, DNA-binding motif // AT hook-like | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGGTCGGAAATACGGTAATGAGCAACCG |
| Internal bar code: | AATTTGAGTAAGTTTGGCGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 417 |
| LEAP-Seq percent confirming: | 97.9779 |
| LEAP-Seq n confirming: | 1066 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCCACCCTGGATCTCAT |
| Suggested primer 2: | GCAAATGCTCGAGTAGAGGG |