| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.049782 |
| Chromosome: | chromosome 1 |
| Location: | 5653833 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g040300 | DNJ9 | Catechol O-methyltransferase; (1 of 1) 2.1.1.6 - Catechol O-methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTTGCGCCCTGTGGCCGGCCCGGCCTCC |
| Internal bar code: | TATCTAGTCGGAGGTTCATACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 404 |
| LEAP-Seq percent confirming: | 99.8661 |
| LEAP-Seq n confirming: | 1492 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCTCACCATCGCTATCTG |
| Suggested primer 2: | GTGGCACTGACTCAGCAGAA |