Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.049826 |
Chromosome: | chromosome 3 |
Location: | 4342405 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g175050 | TRP13 | Transient receptor potential ion channel protein; (1 of 6) PTHR10117 - TRANSIENT RECEPTOR POTENTIAL CHANNEL | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGCTTGGCCTGGCGGCGCTCCTCCTTCA |
Internal bar code: | GCAAGCCCATTGAGTGCGAACC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 791 |
LEAP-Seq percent confirming: | 99.144 |
LEAP-Seq n confirming: | 1969 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGCTGAAGTCAGACCCTAC |
Suggested primer 2: | TCCAGGCACTATACCGGAAC |