| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.049829 |
| Chromosome: | chromosome 11 |
| Location: | 349072 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467573 | LHCA3 | light-harvesting chlorophyll-a/b protein of photosystem I (Type III); (1 of 1) PTHR21649//PTHR21649:SF14 - CHLOROPHYLL A/B BINDING PROTEIN // PSI TYPE III CHLOROPHYLL A/B-BINDING PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTTGCGTTTGGCAAAGTGATCTCGCTCA |
| Internal bar code: | AGGCGAAACTTGATCGTCAGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1148 |
| LEAP-Seq percent confirming: | 99.1879 |
| LEAP-Seq n confirming: | 855 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAACCACTTGATGTTGGTG |
| Suggested primer 2: | GACATGGATACCAGCACACG |