| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.049851 |
| Chromosome: | chromosome 14 |
| Location: | 2984931 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g627950 | SRD2 | 3-oxo-5-alpha-steroid 4-dehydrogenase family protein; (1 of 1) 1.3.1.22 - 3-oxo-5-alpha-steroid 4-dehydrogenase (NADP(+)) / Cholestenone 5-alpha-reductase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCCAATCAACCCTTTCTCCTGGTGGCAG |
| Internal bar code: | TTGTCTTATTTTCGATACCGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 381 |
| LEAP-Seq percent confirming: | 99.8711 |
| LEAP-Seq n confirming: | 1550 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTGTGTGTCGTTTTGTTC |
| Suggested primer 2: | AGGGCTGAACTTGGGAAACT |