| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.049855 |
| Chromosome: | chromosome 2 |
| Location: | 2016725 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g088500 | CPLD29 | (1 of 1) 5.3.3.1 - Steroid Delta-isomerase / Steroid isomerase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAACTTGAGGTCGGAGGGCACCGTCTTGCG |
| Internal bar code: | GTGACGTGCACGCTGTGCGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 900 |
| LEAP-Seq percent confirming: | 97.7752 |
| LEAP-Seq n confirming: | 4219 |
| LEAP-Seq n nonconfirming: | 96 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCAACACAAGAGGCCAGA |
| Suggested primer 2: | TGCGCTACTACGAGGCCTAT |