| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.049858 |
| Chromosome: | chromosome 12 |
| Location: | 3856901 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g515500 | (1 of 1) PF04780 - Protein of unknown function (DUF629) (DUF629) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTGGCACCTGGGCGGCTTGCTTGCCAGC |
| Internal bar code: | CGGCGACTCGCAACATCGCTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 669 |
| LEAP-Seq percent confirming: | 99.7231 |
| LEAP-Seq n confirming: | 2521 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCAGAGGAGGAGGACAAG |
| Suggested primer 2: | GAGCTTGCGCTTGCATCT |