| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.049946 |
| Chromosome: | chromosome 1 |
| Location: | 3820770 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g024750 | STK | (1 of 1) PF00059//PF00069//PF07714//PF14295 - Lectin C-type domain (Lectin_C) // Protein kinase domain (Pkinase) // Protein tyrosine kinase (Pkinase_Tyr) // PAN domain (PAN_4); Serine/threonine protein kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTAGCACTGCAGTGTAGGTGAATTCCGAA |
| Internal bar code: | ACAAGACCTAACACGCCCGGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1041 |
| LEAP-Seq percent confirming: | 99.5108 |
| LEAP-Seq n confirming: | 1017 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGGTGTCCACCAAGAACT |
| Suggested primer 2: | TTCATCAGTGCAAGTCCGAG |