| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.050072 |
| Chromosome: | chromosome 3 |
| Location: | 6245759 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g192550 | RAD50 | DNA repair protein; (1 of 1) K10866 - DNA repair protein RAD50 (RAD50) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTTGGCTTTGGTTTAGTTTGGGCTGGTGT |
| Internal bar code: | ATGGATAGGTCCGCGAAATATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 61 |
| LEAP-Seq percent confirming: | 82.5731 |
| LEAP-Seq n confirming: | 8273 |
| LEAP-Seq n nonconfirming: | 1746 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTAACCCCCACCTGTTCTA |
| Suggested primer 2: | TCATAGTCACGCGCTCATTC |