Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.050178 |
Chromosome: | chromosome 6 |
Location: | 4303596 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g278256 | RPN8 | (1 of 1) K03038 - 26S proteasome regulatory subunit N8 (PSMD7, RPN8); 26S proteasome regulatory subunit | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATACAATCGCACTCCCCACACCAAGCCAG |
Internal bar code: | GTCGCACCGTCTCCCAGTATAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1079 |
LEAP-Seq percent confirming: | 99.7414 |
LEAP-Seq n confirming: | 22369 |
LEAP-Seq n nonconfirming: | 58 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACACACACACACACCACACG |
Suggested primer 2: | GGAGGACTGCAATACGGTGT |