| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.050213 |
| Chromosome: | chromosome 2 |
| Location: | 5924935 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g111700 | EFH1 | (1 of 3) PF13202//PF13499 - EF hand (EF-hand_5) // EF-hand domain pair (EF-hand_7); EF-hand Calcium binding protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAACGGTTTGCGGACGTAGTGAATGCCGG |
| Internal bar code: | CTACCATACAGTTGGTGCCAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 692 |
| LEAP-Seq percent confirming: | 94.9055 |
| LEAP-Seq n confirming: | 1807 |
| LEAP-Seq n nonconfirming: | 97 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCTTGAGCTGCTTCTTCA |
| Suggested primer 2: | ACATATCGGACTTTCGGACG |