| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.050215 |
| Chromosome: | chromosome 10 |
| Location: | 1702341 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g430250 | ELG21 | Exostosin-like glycosyltransferase 21; (1 of 2) IPR000742//IPR004263//IPR013111 - EGF-like domain // Exostosin-like // EGF-like domain, extracellular | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTCTAACACATGGTGTGCATCTGACGAC |
| Internal bar code: | GCAGAGTGAGAATTTGGATGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 828 |
| LEAP-Seq percent confirming: | 98.5355 |
| LEAP-Seq n confirming: | 3095 |
| LEAP-Seq n nonconfirming: | 46 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACACACACACACACCGT |
| Suggested primer 2: | CGGCTACCTTCATGGTTGTT |