| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.050229 |
| Chromosome: | chromosome 7 |
| Location: | 5732656 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g352900 | (1 of 1) PF00400//PF02141 - WD domain, G-beta repeat (WD40) // DENN (AEX-3) domain (DENN) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGGTCCACGTGCACACACACCATGTATC |
| Internal bar code: | CATTCTCCGGCCATTTTGACCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 60 |
| LEAP-Seq percent confirming: | 99.0527 |
| LEAP-Seq n confirming: | 7006 |
| LEAP-Seq n nonconfirming: | 67 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCTACCCTTGCATGGTCT |
| Suggested primer 2: | AGAGATCGCAACGAGCATTT |