Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.050233 |
Chromosome: | chromosome 5 |
Location: | 606097 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g232050 | (1 of 37) IPR008979 - Galactose-binding domain-like | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGGTGGTGTCGGGCTCCCTGGCAGGAGA |
Internal bar code: | CGCCGCACGTCTAACTTGTGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 328 |
LEAP-Seq percent confirming: | 55.5772 |
LEAP-Seq n confirming: | 1141 |
LEAP-Seq n nonconfirming: | 912 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAGAGTCGCCTGCACCACT |
Suggested primer 2: | ACTTCTCTCCGCAATGTGCT |